SubtiBank SubtiBank
Version comparison:

2019-02-07 14:51:422018-07-30 12:42:23

geneLength

759

756

Gene

Coordinates

4,197,780 4,198,538

4,197,780 → 4,198,538

Gene

Phenotypes of a mutant

an ''[[gene|exoR]] [[gene|nfo]]'' double mutant is impaired in germination and spore outgrowth due to the accumulation of DNA lesions, this can be rescued by inactivation of ''[[gene|disA]]'' [Pubmed|24244006]

an ''[[gene|exoR]] [[gene|nfo]]'' double mutant is sensitive to radiation [Pubmed|24123749]

sensitive to blue light-induced DNA damage [pubmed|30054368]

an ''[[gene|exoR]] [[gene|nfo]]'' double mutant is impaired in germination and spore outgrowth due to the accumulation of DNA lesions, this can be rescued by inactivation of ''[[gene|disA]]'' [Pubmed|24244006]

an ''[[gene|exoR]] [[gene|nfo]]'' double mutant is sensitive to radiation [Pubmed|24123749]

The protein

Paralogous protein(s)

[[this]]

Biological materials

Mutant

GP898 (''exoA''::''kan''), available in [SW|Jrg Stlke]'s lab

GP1503 (''exoA''::''kan'', [[gene|nfo]]::''cat''), available in [SW|Jrg Stlke]'s lab

BKE40880 ([[gene|exoA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT, downstream forward: _UP4_TGATGAGATAGCAGTAAGGA

BKK40880 ([[gene|exoA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT, downstream forward: _UP4_TGATGAGATAGCAGTAAGGA

GP898 (Δ''exoA''::''kan''), available in [SW|Jörg Stülke]'s lab

GP1503 (Δ''exoA''::''kan'', Δ[[gene|nfo]]::''cat''), available in [SW|Jörg Stülke]'s lab

BKE40880 (Δ[[gene|exoA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT, downstream forward: _UP4_TGATGAGATAGCAGTAAGGA

BKK40880 (Δ[[gene|exoA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT, downstream forward: _UP4_TGATGAGATAGCAGTAAGGA

References

Original publications

24244006, 18203828, 16237020, 19930460, 10540738, 21441501, 24123749, 24123749, 24914186, 27343627, 30054368

24244006, 18203828, 16237020, 19930460, 10540738, 21441501, 24123749, 24123749, 24914186, 27343627